rvprimer3 (forward Search Results


rvprimer3 (forward  (Promega)
90
Promega rvprimer3 (forward
Rvprimer3 (Forward, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rvprimer3 (forward/product/Promega
Average 90 stars, based on 1 article reviews
rvprimer3 (forward - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
phb2 luciferase plasmid pgl4.10-promoter phb2 wt  (Obio Technology Corp Ltd)
90
Obio Technology Corp Ltd phb2 luciferase plasmid pgl4.10-promoter phb2 wt
Nrf2 deficiency aggravates SA‐ALI with mitochondrial dysfunction. (A) Pathological changes in lung tissue due to sepsis and Nrf2 deficiency. (magnification, ×100 and ×400, bar = 200 and 100 μm; n = 5). (B) Lung injury scores based on the pathological results. (C and D) Cell counts and protein concentration in BALF from mice. (E and F) Levels of serum SOD and LDH from Nrf2 −/− mice. (G–I) The relative mRNA levels of complex IV, COX‐1, and ND‐1 were used to reflect the mtDNA copy number. (J) <t>PHB2</t> mRNA level in lung tissue. Experiments were repeated at least three times. * p < 0.05, ** p < 0.01, **** p < 0.0001, ns denotes not significant.
Phb2 Luciferase Plasmid Pgl4.10 Promoter Phb2 Wt, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phb2 luciferase plasmid pgl4.10-promoter phb2 wt/product/Obio Technology Corp Ltd
Average 90 stars, based on 1 article reviews
phb2 luciferase plasmid pgl4.10-promoter phb2 wt - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Nrf2 deficiency aggravates SA‐ALI with mitochondrial dysfunction. (A) Pathological changes in lung tissue due to sepsis and Nrf2 deficiency. (magnification, ×100 and ×400, bar = 200 and 100 μm; n = 5). (B) Lung injury scores based on the pathological results. (C and D) Cell counts and protein concentration in BALF from mice. (E and F) Levels of serum SOD and LDH from Nrf2 −/− mice. (G–I) The relative mRNA levels of complex IV, COX‐1, and ND‐1 were used to reflect the mtDNA copy number. (J) PHB2 mRNA level in lung tissue. Experiments were repeated at least three times. * p < 0.05, ** p < 0.01, **** p < 0.0001, ns denotes not significant.

Journal: MedComm

Article Title: Nrf2/PHB2 alleviates mitochondrial damage and protects against Staphylococcus aureus ‐induced acute lung injury

doi: 10.1002/mco2.448

Figure Lengend Snippet: Nrf2 deficiency aggravates SA‐ALI with mitochondrial dysfunction. (A) Pathological changes in lung tissue due to sepsis and Nrf2 deficiency. (magnification, ×100 and ×400, bar = 200 and 100 μm; n = 5). (B) Lung injury scores based on the pathological results. (C and D) Cell counts and protein concentration in BALF from mice. (E and F) Levels of serum SOD and LDH from Nrf2 −/− mice. (G–I) The relative mRNA levels of complex IV, COX‐1, and ND‐1 were used to reflect the mtDNA copy number. (J) PHB2 mRNA level in lung tissue. Experiments were repeated at least three times. * p < 0.05, ** p < 0.01, **** p < 0.0001, ns denotes not significant.

Article Snippet: The PHB2 luciferase plasmid pGL4.10‐promoter PHB2 wt (forward primer [RVprimer3], CTAGCAAAATAGGCTGTCCC; reverse primer [Luc2‐N‐Re], CGTCTTCGAGTGGGTAGAATG) and control vector H352 pGL4.10 were constructed by OBiO Technology.

Techniques: Protein Concentration

Nrf2 modulates PHB2 expression and intracellular distribution during SA‐ALI. (A and C) In vivo, mitochondrial and cytosolic fractions were collected from lung tissues. Western blots were used to determine the expression of PHB2. VDAC1 and GAPDH was utilized as the loading control for mitochondrial and cytosolic fraction, respectively. (B, D, and E) Quantitative analysis of bands for total‐, mito‐ and cyto‐PHB2. (F) A549 cells were transfected with Nrf2‐OE or empty (NC) plasmid for 48 h. Total Nrf2 and PHB2 protein expression were determined by western blot. (G) Cyto‐ and mito‐PHB2 were measured in A549 cells. Experiments were repeated at least three times. * p < 0.05, ** p < 0.01, *** p < 0.001, ns denotes not significant.

Journal: MedComm

Article Title: Nrf2/PHB2 alleviates mitochondrial damage and protects against Staphylococcus aureus ‐induced acute lung injury

doi: 10.1002/mco2.448

Figure Lengend Snippet: Nrf2 modulates PHB2 expression and intracellular distribution during SA‐ALI. (A and C) In vivo, mitochondrial and cytosolic fractions were collected from lung tissues. Western blots were used to determine the expression of PHB2. VDAC1 and GAPDH was utilized as the loading control for mitochondrial and cytosolic fraction, respectively. (B, D, and E) Quantitative analysis of bands for total‐, mito‐ and cyto‐PHB2. (F) A549 cells were transfected with Nrf2‐OE or empty (NC) plasmid for 48 h. Total Nrf2 and PHB2 protein expression were determined by western blot. (G) Cyto‐ and mito‐PHB2 were measured in A549 cells. Experiments were repeated at least three times. * p < 0.05, ** p < 0.01, *** p < 0.001, ns denotes not significant.

Article Snippet: The PHB2 luciferase plasmid pGL4.10‐promoter PHB2 wt (forward primer [RVprimer3], CTAGCAAAATAGGCTGTCCC; reverse primer [Luc2‐N‐Re], CGTCTTCGAGTGGGTAGAATG) and control vector H352 pGL4.10 were constructed by OBiO Technology.

Techniques: Expressing, In Vivo, Western Blot, Control, Transfection, Plasmid Preparation

Nrf2 binds to the PHB2 promoter and enhances gene transcription. (A) Input DEGs of GSE95233 into ChEA3 ( https://maayanlab.cloud/chea3/ ) to obtain the downstream of Nrf2. (B) Dual‐luciferase reporter system was used to test Nrf2 binds to the PHB2 promoter region. The thymidine kinase promoter‐renilla luciferase (pRL‐TK) vector was transfected as an internal reference to correct the transfection efficiency. (C–E) The relative levels of complex IV, ND‐1, and COX‐1 were used to reflect the mtDNA copy number. (F) ATP content was measured in A549 cells treated with Nrf2‐OE plasmid and PHB2 siRNA. Experiments were repeated at least three times * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001, ns denotes not significant.

Journal: MedComm

Article Title: Nrf2/PHB2 alleviates mitochondrial damage and protects against Staphylococcus aureus ‐induced acute lung injury

doi: 10.1002/mco2.448

Figure Lengend Snippet: Nrf2 binds to the PHB2 promoter and enhances gene transcription. (A) Input DEGs of GSE95233 into ChEA3 ( https://maayanlab.cloud/chea3/ ) to obtain the downstream of Nrf2. (B) Dual‐luciferase reporter system was used to test Nrf2 binds to the PHB2 promoter region. The thymidine kinase promoter‐renilla luciferase (pRL‐TK) vector was transfected as an internal reference to correct the transfection efficiency. (C–E) The relative levels of complex IV, ND‐1, and COX‐1 were used to reflect the mtDNA copy number. (F) ATP content was measured in A549 cells treated with Nrf2‐OE plasmid and PHB2 siRNA. Experiments were repeated at least three times * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001, ns denotes not significant.

Article Snippet: The PHB2 luciferase plasmid pGL4.10‐promoter PHB2 wt (forward primer [RVprimer3], CTAGCAAAATAGGCTGTCCC; reverse primer [Luc2‐N‐Re], CGTCTTCGAGTGGGTAGAATG) and control vector H352 pGL4.10 were constructed by OBiO Technology.

Techniques: Luciferase, Plasmid Preparation, Transfection